| Detail of EST/Unigene TCMT56758 |
| Acc. | TCMT56758 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 15 OS=Arabidopsis thaliana E-value=4e-88; Beta-glucosidase 13 OS=Arabidopsis thaliana E-value=4e-88; Beta-glucosidase 12 OS=Arabidopsis thaliana E-value=2e-87; Beta-glucosidase 16 OS=Arabidopsis thaliana E-value=5e-87; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=7e-84; |
| Length | 1113 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (3 ESTs); MT_HOGA (3 ESTs); MT_DLEAF (1 ESTs); |
| Sequence | GTGATTCTAGTACTGAGCCCTATGTAGTTACACACCACCTGATTCTTTCTCACGCTGCAG |
| EST members of Unigene | CX541475 CX537334 BQ146224 BG455050 CB894670 CB894090 CB894011 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.11124.1.S1_at, Mtr.14951.1.S1_s_at
|
| Corresponding NCBI Gene | 834493 |
| Trichome-related Gene from Literature | N/A |