Detail of EST/Unigene TCMT59361 |
Acc. | TCMT59361 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=4e-75; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=1e-49; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=1e-48; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-45; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=4e-45; |
Length | 929 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTAMP (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_NOD_ROOT (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | GGAAAACCAGTTGTTTGAGTACAGAATTGATCAAGCCCTACGATGGCATCAAATAAGGAA |
EST members of Unigene | BE319318 AJ502035 AJ501338 CX535322 CX531396 EY477064 GE349491 GE344416 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10494.1.S1_x_at, Mtr.2921.1.S1_at
|
Corresponding NCBI Gene | 820083 |
Trichome-related Gene from Literature | N/A |