| Detail of EST/Unigene TCMT59920 |
| Acc. | TCMT59920 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=5e-72; Geraniol 8-hydroxylase OS=Swertia mussotii E-value=6e-70; 7-ethoxycoumarin O-deethylase OS=Helianthus tuberosus E-value=4e-68; Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=1e-62; Cytochrome P450 76C1 OS=Arabidopsis thaliana E-value=6e-60; |
| Length | 1122 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_DROOT (1 ESTs); MTAMP (1 ESTs); MT_LEAF_PHOMA (1 ESTs); |
| Sequence | GGGTATTGAACAAGTTCAATAGCTCATAGTTCTCTCAAAAAAATGGACTTGTTACAAAGT |
| EST members of Unigene | AW687915 AJ502649 BQ139818 BF635578 BF634128 GE346143 GE346142 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.44354.1.S1_at
|
| Corresponding NCBI Gene | 840263 |
| Trichome-related Gene from Literature | N/A |