Detail of EST/Unigene TCMT60262 |
Acc. | TCMT60262 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-76; Argininosuccinate synthase OS=Desulfitobacterium hafniense (strain Y51) E-value=2e-57; Argininosuccinate synthase OS=Desulfitobacterium hafniense (strain DCB-2 / DSM 10664) E-value=2e-57; Argininosuccinate synthase OS=Desulfotomaculum reducens (strain MI-1) E-value=1e-54; Argininosuccinate synthase OS=Roseiflexus sp. (strain RS-1) E-value=4e-54; |
Length | 727 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (3 ESTs); MT_ROOTPHOS (1 ESTs); MT_MGHG (1 ESTs); |
Sequence | GATGCTCCAAACGAGCCAGAATATGTGGAGATTGGATTTGAGTTAGGCATTCCAGTATCG |
EST members of Unigene | AL385507 AL384650 AL384649 AW125967 BE941318 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
EC | 6.3.4.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.52006.1.S1_s_at
|
Corresponding NCBI Gene | 828586 |
Trichome-related Gene from Literature | N/A |