| Detail of EST/Unigene TCMT60733 |
| Acc. | TCMT60733 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Dolichol phosphate-mannose biosynthesis regulatory protein OS=Mus musculus E-value=4e-20; Dolichol phosphate-mannose biosynthesis regulatory protein OS=Rattus norvegicus E-value=1e-19; Dolichol phosphate-mannose biosynthesis regulatory protein OS=Cricetulus griseus E-value=4e-19; Dolichol phosphate-mannose biosynthesis regulatory protein OS=Homo sapiens E-value=1e-18; Dolichol phosphate-mannose biosynthesis regulatory protein OS=Bos taurus E-value=3e-17; |
| Length | 592 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (2 ESTs); MTPOSE (1 ESTs); |
| Sequence | ATTGGAGAAAAGTAACATCAAGTCATCAACTACCTTCTCAACCGATCGTATAAAGAAAAA |
| EST members of Unigene | AJ498715 GE351818 GE347418 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01031 Glycan structures - Biosynthesis 2 > K09658 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit [CAZy:GT2]; Metabolism > Glycan Biosynthesis and Metabolism > ko00563 Glycosylphosphatidylinositol(GPI)-anchor biosynthesis > K09658 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit [CAZy:GT2]; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K09658 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit [CAZy:GT2] |
| EC | 2.4.1.83 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.26367.1.S1_s_at
|
| Corresponding NCBI Gene | 843775 |
| Trichome-related Gene from Literature | N/A |