Detail of EST/Unigene TCMT61904 |
Acc. | TCMT61904 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Formimidoyltransferase-cyclodeaminase OS=Sus scrofa E-value=1e-06; Formimidoyltransferase-cyclodeaminase OS=Dictyostelium discoideum E-value=1e-05; |
Length | 717 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | GGCACCTTGTACACGAGTTCCCACTTCAAGTTATTAGTTTAAGTAACTTTGTGAACACAA |
EST members of Unigene | AW267905 EY477677 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00340 Histidine metabolism > K00603 glutamate formiminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00603 glutamate formiminotransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K01746 formiminotetrahydrofolate cyclodeaminase |
EC | 2.1.2.5 4.3.1.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.1536.1.S1_at, Mtr.1536.1.S1_s_at
|
Corresponding NCBI Gene | 816615 |
Trichome-related Gene from Literature | N/A |