| Detail of EST/Unigene TCNB51504 |
| Acc. | TCNB51504 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=0; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=0; Trans-cinnamate 4-monooxygenase OS=Populus tremuloides E-value=0; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=0; Trans-cinnamate 4-monooxygenase OS=Helianthus tuberosus E-value=0; |
| Length | 1057 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | LIBEST_024542 (7 ESTs); LIBEST_024545 (2 ESTs); NB_GTISSUE (1 ESTs); LIBEST_024543 (1 ESTs); |
| Sequence | CCCATTTCTCCCCCCAAAAATATCATTTCTCTCGTCTAAAATGGATCTTCACTTACTAGA |
| EST members of Unigene | GO602011 GO608220 EH365393 GO608511 GO605034 GO612183 GO602051 GO608977 GO612235 GO601113 GO601846 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |