Detail of EST/Unigene TCNB51532 |
Acc. | TCNB51532 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; |
Length | 1031 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US (90 ESTs); |
Sequence | AAAAAATATGAAAAGATCACATGTTCTTCATTAATTAATCCAAACCAATTTACACCACAT |
EST members of Unigene | CN745774 CN747916 CN743219 CN744790 CN742425 CN748313 CN748312 CN742026 CN741636 CN746930 CN746558 CN743625 CN655467 CN741668 CN742248 CN745204 CN745986 CN745003 CN748534 CN747929 CN745981 CN744242 CN747714 CN747313 CN744555 CN747475 CN748469 CN747275 CN745130 CN747465 CN741386 CN742760 CN741574 CN748867 CN744177 CN743405 CN655421 CN743994 CN746722 CN743990 CN741815 CN748884 CN747495 CN744178 CN743545 CN743151 CN655541 CN747618 CN746053 CN744096 CN743698 CN745658 CN747995 CN745452 CN748390 CN743316 CN747423 CN748039 CN741759 CN744907 CN747835 CN746854 CN744901 CN746463 CN747232 CN745088 CN747793 CN745057 CN747392 CN746993 CN655493 CN747574 CN748762 CN742276 CN747568 CN743460 CN742469 CN747560 CN746996 CN747189 CN745047 CN743290 CN748389 CN745448 CN743881 CN743683 CN743880 CN744857 CN742097 CN741508 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |