Detail of EST/Unigene TCNB51694 |
Acc. | TCNB51694 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=9e-85; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Rattus norvegicus E-value=3e-51; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=6e-51; |
Length | 935 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | LIBEST_024542 (18 ESTs); LIBEST_024544 (2 ESTs); NB_SAL_US (1 ESTs); NB_MTISSUE (1 ESTs); |
Sequence | ACACAAAGTAGAAAACTAGCTCCAAAAATATCCTAATCTATTTTTAGAGTAATTTGTACT |
EST members of Unigene | GO604503 GO607812 GO604926 GO603373 GO611347 CN748490 GO601468 GO603102 GO602107 GO603859 GO603978 GO600192 CK292241 GO607699 GO604210 GO603011 GO604592 GO606513 GO603036 GO604347 GO602959 GO610553 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817876 |
Trichome-related Gene from Literature | 817876 |