Detail of EST/Unigene TCNT53866 |
Acc. | TCNT53866 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=5e-89; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=3e-80; |
Length | 1220 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (4 ESTs); NT_EITL (1 ESTs); |
Sequence | ACAATTTCAGCTCAAGTGTTTCTTACTCTCTCATTTCCATTTTAGCTATGACTTTATGCA |
EST members of Unigene | EG649916 TOBPRNA TOBPR2A TOBPR0A TOBGL153A FS385248 FS389754 FS418184 EH622478 FS431358 EG649771 EH623433 EG649770 FS393870 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |