| Detail of EST/Unigene TCNT53867 |
| Acc. | TCNT53867 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=5e-97; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=2e-96; Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=2e-94; |
| Length | 1193 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | |
| Sequence | TCTCTCATTTCCATTTTAGCTATGGCTTTGTGCATTAAAAATGGCTTTCTTGCGGCTGCC |
| EST members of Unigene | FS385248 TOBGL153A TOBPR0A TOBPR2A TOBPRNA EG649916 EH623433 EG649770 EH622478 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |