Detail of EST/Unigene TCSA10596 |
Acc. | TCSA10596 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=0; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=0; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=0; |
Length | 1488 nt |
Species | Solanum arcanum |
Belonged EST Libraries | |
Sequence | TAGAGACCGAGGCGGCCGACATGTGTTTTGTTTTTCTTTTTTTTGCAAAGCAAGCGAAAT |
EST members of Unigene | SRR027943.109948 SRR027943.246551 SRR027943.347275 SRR027943.152479 SRR027943.95056 SRR027943.122906 SRR027943.77762 SRR027943.325454 SRR027943.60439 SRR027943.319536 SRR027943.102280 SRR027943.470176 SRR027943.392348 SRR027943.379218 SRR027943.427019 SRR027943.189870 SRR027943.226982 SRR027943.431960 SRR027943.44572 SRR027943.247389 SRR027943.429597 SRR027943.350443 SRR027943.428611 SRR027943.188905 SRR027943.484685 SRR027943.489782 SRR027943.352977 SRR027943.24876 SRR027943.392785 SRR027943.85841 SRR027943.138637 SRR027943.278180 SRR027943.359731 SRR027943.161969 SRR027943.300824 SRR027943.87282 SRR027943.25925 SRR027943.9350 SRR027943.39677 SRR027943.488248 SRR027943.187000 SRR027943.1799 SRR027943.490414 SRR027943.104131 SRR027943.415734 SRR027943.366797 SRR027943.445494 SRR027943.202456 SRR027943.86558 SRR027943.438509 SRR027943.1088 SRR027943.41909 SRR027943.397409 SRR027943.16909 SRR027943.96743 SRR027943.9391 SRR027943.342060 SRR027943.315162 SRR027943.389946 SRR027943.286504 SRR027943.374063 SRR027943.338153 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.-.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |