| Detail of EST/Unigene TCSH52017 |
| Acc. | TCSH52017 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=0; Glyceraldehyde-3-phosphate dehydrogenase OS=Atriplex nummularia E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Dianthus caryophyllus E-value=0; |
| Length | 1116 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941 (52 ESTs); SRR027940 (13 ESTs); LIBEST_025268 (1 ESTs); |
| Sequence | TTTTGGTGAGAAGGCTGTTACTGTTTTTGGGTTTAGGAACCCAGAGGAAATTCCATGGGC |
| EST members of Unigene | SRR027941.72395 SRR027940.108881 SRR027941.214906 SRR027941.72403 SRR027941.78086 SRR027941.57655 SRR027941.104418 SRR027940.98446 SRR027941.196358 SRR027941.270613 SRR027941.105223 SRR027941.33294 SRR027941.80496 SRR027941.218722 SRR027941.275286 SRR027941.219560 SRR027941.163476 SRR027941.241950 SRR027941.181333 SRR027941.205920 SRR027941.149718 SRR027941.188760 SRR027941.301766 SRR027941.183933 SRR027941.9245 SRR027941.249044 SRR027941.293643 SRR027941.95323 SRR027941.295268 SRR027941.256502 SRR027940.106976 SRR027941.272275 SRR027940.83450 SRR027941.235045 SRR027940.9889 SRR027941.41641 SRR027941.49073 SRR027941.111027 SRR027941.225088 SRR027940.76723 SRR027940.110130 SRR027940.126923 SRR027940.72461 SRR027941.193229 SRR027941.237374 SRR027941.245258 SRR027941.266234 SRR027940.86744 SRR027941.47029 SRR027940.40605 SRR027941.146124 SRR027941.140098 SRR027941.121667 SRR027941.291948 SRR027940.72346 SRR027941.256035 SRR027940.82573 SRR027941.50738 SRR027941.116772 SRR027941.225740 SRR027941.150588 SRR027941.192666 SRR027941.242461 SRR027941.49898 GT172342 SRR027941.306086 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00134 glyceraldehyde 3-phosphate dehydrogenase |
| EC | 1.2.1.12 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819567 |
| Trichome-related Gene from Literature | 819567 |