Detail of EST/Unigene TCSL71251 |
Acc. | TCSL71251 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=0; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=0; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Zea mays E-value=0; |
Length | 1102 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | |
Sequence | GGCCATTACGGCCGGGGGTTTCTTCAGGAGAAACATGGTTCAAAAATGGCCTTTTTAGAT |
EST members of Unigene | SRR015435.308669 SRR015436.182503 SRR015435.88273 SRR015436.289702 SRR015436.335999 SRR015436.296678 SRR015436.26876 SRR015436.122054 SRR015435.313910 SRR015436.42692 BG630592 SRR015436.134014 SRR015435.59644 SRR015436.223468 SRR015435.357385 SRR015435.133068 SRR015435.282341 SRR015435.186070 SRR015435.179228 EF650011 SRR015436.319927 SRR015435.306645 BW686412 SRR015436.236145 SRR015436.322301 SRR015436.164675 SRR015435.320172 SRR015435.188641 SRR015436.137301 BG631850 SRR015436.162448 SRR015436.30808 SRR015435.279177 SRR015436.161678 SRR015436.52833 SRR015435.325872 SRR015435.264250 SRR015436.223802 SRR015436.324968 SRR015436.191129 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827061 |
Trichome-related Gene from Literature | 827061 |