Detail of EST/Unigene TCSL72453 |
Acc. | TCSL72453 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=0; |
Length | 952 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_SUS_LEAF (3 ESTs); SL_Lyc_leaf (1 ESTs); SL_Seedlings (1 ESTs); |
Sequence | GCCAACTTCAACAATATCTCATACCATCAAACACTTACATTTCTCTTGATATAAACACCA |
EST members of Unigene | AI772487 BP898781 GH622818 BP903804 BP904185 BG128679 BP896068 BP899542 CK714976 BP898766 AI772854 BP910187 AI777644 CK715022 BG125237 BP896682 BP898804 BP896100 BG125423 BG629470 AW039748 AI482857 BP903043 AI482855 BP900503 AW091924 AI780432 AI780431 AI780430 BP908591 BP901058 AW038305 BG124385 AI780226 AW037912 BP898533 BG126910 BP897005 BP899711 AW096557 BP896827 BP898757 BP898563 AI772067 AW041843 BP901653 BP903582 BG124018 AI774275 SRR015436.4973 AW443877 AW093631 BP909132 AI772787 AI775104 AI779026 BP900816 AW039642 AI780766 BP906796 SRR015435.189643 BP900830 AI781566 BP900060 BP897367 AW092155 BP897945 AI777486 BP897943 BP900453 BP898522 BP899097 BG123788 CK715135 BP904276 AI776583 AW040382 BP901161 BP907533 AI778781 AI778780 BP899221 BP897480 AW443008 AI772326 BP910409 BP909470 AW094356 BP911211 AI774695 BP900793 BP897121 AI782305 AI777152 AW094562 BP905423 AW443032 BP897501 BP901558 AI774679 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |