| Detail of EST/Unigene TCSL74631 |
| Acc. | TCSL74631 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=0; Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=0; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=0; Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica E-value=0; |
| Length | 1579 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (17 ESTs); SRR015436 (8 ESTs); SL_MicroLEAF3 (3 ESTs); SL_PRERIP_FRUIT_TAMU (2 ESTs); LIBEST_024426 (2 ESTs); LIBEST_024457 (1 ESTs); SL_CDS (1 ESTs); LIBEST_024456 (1 ESTs); SL_breaker_fruit (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_maturing_fruit (1 ESTs); SL_flower_buds3 (1 ESTs); SL_FLOWERBUDS (1 ESTs); LIBEST_025267 (1 ESTs); SL_FRUIT (1 ESTs); SL_TAMU (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGGATCTTTCACGATTCAGATCTGCTTGACCCCAAACTTCACTTTC |
| EST members of Unigene | SRR015435.178186 SRR015436.105052 SRR015436.81231 AY261513 SRR015435.345640 SRR015435.216728 GT168531 SRR015435.60702 SRR015435.111267 BM412084 SRR015435.345461 SRR015435.166980 SRR015435.75707 SRR015436.159107 SRR015435.94888 SRR015435.122390 SRR015436.68131 SRR015435.330578 AW931285 AW931890 BP878372 SRR015435.58942 DB701743 SRR015436.290034 AI898347 AW738199 SRR015435.145318 DB693473 FS196267 BE433653 GO374563 FS200193 BI926592 GO373421 SRR015435.84712 SRR015436.104794 DB685048 SRR015435.56021 SRR015436.333675 SRR015436.290041 SRR015435.221733 AW928948 SRR015435.109102 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
| EC | 2.7.11.24 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
|
| Corresponding NCBI Gene | 818982 |
| Trichome-related Gene from Literature | 818982 |