| Detail of EST/Unigene TCSL75613 |
| Acc. | TCSL75613 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | GLABRA2 expression modulator OS=Arabidopsis thaliana E-value=1e-94; GEM-like protein 1 OS=Arabidopsis thaliana E-value=9e-76; Putative GEM-like protein 3 OS=Arabidopsis thaliana E-value=2e-74; GEM-like protein 5 OS=Arabidopsis thaliana E-value=1e-43; GEM-like protein 2 OS=Arabidopsis thaliana E-value=4e-42; |
| Length | 1260 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (17 ESTs); LIBEST_024426 (3 ESTs); SRR015436 (3 ESTs); SL_maturing_fruit (2 ESTs); SL_SHOOT_4WEEK (2 ESTs); SL_flower_anthesis (2 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_pericarp (1 ESTs); SL_FRUIT (1 ESTs); SL_TAMU (1 ESTs); SL_SUS_LEAF (1 ESTs); LIBEST_024457 (1 ESTs); SL_Lyc_leaf (1 ESTs); SL_TRI (1 ESTs); SL_cTOS (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGATATTTCAACATCATAAGTCGCTGTTTTTCCCCGAGGTACCCAC |
| EST members of Unigene | AW221418 SRR015435.51641 BP895701 SRR015435.133397 SRR015435.126234 BI934545 BI204094 SRR015435.289256 GO374512 BG130408 SRR015435.117192 AI896748 BE435703 CD002139 SRR015435.172990 SRR015435.281936 SRR015435.124709 SRR015436.44914 SRR015435.298548 AI487286 SRR015436.307651 BP900819 SRR015435.153237 SRR015435.51130 BG130352 SRR015435.104613 ES890281 SRR015436.87270 SRR015435.305425 FS199333 FS180897 SRR015435.61867 BP880109 AI782099 FS206142 SRR015435.176963 BI935002 SRR015435.72287 SRR015435.280265 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816780 |
| Trichome-related Gene from Literature | 816780 |