Detail of EST/Unigene TCSL76210 |
Acc. | TCSL76210 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable WRKY transcription factor 70 OS=Arabidopsis thaliana E-value=4e-32; Probable WRKY transcription factor 54 OS=Arabidopsis thaliana E-value=1e-26; Probable WRKY transcription factor 67 OS=Arabidopsis thaliana E-value=3e-23; Probable WRKY transcription factor 62 OS=Arabidopsis thaliana E-value=6e-22; Probable WRKY transcription factor 63 OS=Arabidopsis thaliana E-value=1e-21; |
Length | 1146 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_cTOS (14 ESTs); SL_TAMU (10 ESTs); SL_TAMU_CALLUS (9 ESTs); SL_PRERIP_FRUIT_TAMU (5 ESTs); SL_MicroLEAF3 (4 ESTs); SL_CROWNGALL (3 ESTs); SL_breaker_fruit (2 ESTs); SL_SHOOT_4WEEK (2 ESTs); SL_RIP_FRUIT_TAMU (1 ESTs); SL_MicroFRUIT (1 ESTs); SL_FRUIT (1 ESTs); SRR015435 (1 ESTs); LIBEST_024426 (1 ESTs); SL_CALLUS (1 ESTs); SL_ROOT (1 ESTs); SL_pericarp (1 ESTs); |
Sequence | TCAAAATACACATATGGATAACTCATCGACTGATCTAAATAGAGCAATAGAAGGTTTAAT |
EST members of Unigene | BG642706 AI487658 AW222564 AI490432 BE431784 AI897219 BI211059 AW622284 BI210870 AI897712 AW034058 DB690510 BI205034 DB692099 BI206181 AI484462 AW933763 AW217125 BM412776 BG131215 BI206742 BG132378 AW030408 BI208100 CD002935 DB713503 DB683036 AI898882 AI484758 AW034060 AW029757 BI208998 AW216503 BI206504 BM535587 AW933933 AI484450 AI898381 SRR015435.121462 AI897998 AW930058 BI208842 AW030536 AW930796 AW033040 BI206831 BI207411 BI208571 BI207029 DB692172 BI207809 BI921911 BG133444 AW032456 AW930194 FS189908 BG127023 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824807 |
Trichome-related Gene from Literature | 824807 |