| Detail of EST/Unigene TCSL76805 |
| Acc. | TCSL76805 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Auxin-responsive protein IAA4 OS=Arabidopsis thaliana E-value=7e-62; Auxin-induced protein 22B OS=Vigna radiata var. radiata E-value=4e-61; Auxin-induced protein 22D OS=Vigna radiata var. radiata E-value=1e-60; Auxin-responsive protein IAA3 OS=Arabidopsis thaliana E-value=9e-60; Auxin-induced protein IAA4 OS=Pisum sativum E-value=5e-58; |
| Length | 1044 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (6 ESTs); SL_PRERIP_FRUIT_TAMU (5 ESTs); SL_cTOS (3 ESTs); SL_CELL_BTI (3 ESTs); SL_RIP_FRUIT_TAMU (3 ESTs); SL_TAMU_CALLUS (2 ESTs); SL_GFRUIT (2 ESTs); SL_SHOOT_4WEEK (2 ESTs); SL_maturing_fruit (2 ESTs); SL_germ_seedlings_TAMU (2 ESTs); SL_FRUIT (1 ESTs); SL_CALLUS (1 ESTs); SL_radicle (1 ESTs); SL_CROWNGALL (1 ESTs); SL_pericarp (1 ESTs); SL_CDS (1 ESTs); SL_TRI (1 ESTs); SL_MicroLEAF3 (1 ESTs); SRR015436 (1 ESTs); LIBEST_024426 (1 ESTs); SL_MicroFRUIT2 (1 ESTs); SL_breaker_fruit (1 ESTs); SL_Seedlings (1 ESTs); |
| Sequence | CAGAGTGGCCATTACGGCCGGGGGAAACCAATCTTGGAGAAGAAAAATCATCAGTTTTGG |
| EST members of Unigene | BG123661 BE459745 ES894307 BG134349 BW692897 DB688684 AW221994 AF022012 CD002206 AW033932 AW650070 CK715151 SRR015435.1336 AW649241 BE432711 SRR015435.37298 FS197239 BP885608 BE353145 SRR015435.221460 AW221995 BI209698 AW221996 AW442448 AW932915 AW443823 SRR015435.162177 SRR015435.197613 AW220472 AW220473 AW220474 BF112876 BI923259 BI209735 AW031175 BE458182 BI209717 SRR015435.113209 AW094345 AW933089 BG125071 SRR015436.309066 BP885900 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | ARF |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834390 |
| Trichome-related Gene from Literature | 834390 |