Detail of EST/Unigene TCSL76905 |
Acc. | TCSL76905 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
Length | 1030 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_Lyc_leaf (40 ESTs); SL_SHOOT_4WEEK (14 ESTs); SL_RES (13 ESTs); SL_CELL_BTI (12 ESTs); SL_SUS_LEAF (6 ESTs); SL_MicroLEAF3 (3 ESTs); SL_FLOWER_DEV (3 ESTs); SL_flowerbuds4 (2 ESTs); SL_flower_buds8 (2 ESTs); SL_flower_buds3 (2 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_FLOWER (1 ESTs); |
Sequence | GCAGCCTTCAACAATATTTAATACCATAAAATACTCAACACTTTTCTCTTAATATAAATC |
EST members of Unigene | AI774620 BP904976 BP896285 AI772109 BP901104 BP897236 AW443818 BP906696 BG129832 BP898384 AW039558 BP895903 BI932798 BP899199 BP905957 BG124272 BP901516 BG123508 BP902865 AI777296 AI776769 BG643861 BP908074 BG627127 BG125777 BP896837 BP900671 BG127482 AW624500 AI776897 AI774759 BI926455 AW093063 AI780033 BP901820 BP901240 AI774573 BP903963 BG125967 AI779681 BP901278 BG631365 AW929519 BG125380 BP900491 BG127112 BG734577 BP899134 BP900271 AW442602 BP897176 AW443272 AI774725 BP900827 AW944784 BP900235 AI778825 AI778824 BP904091 AI782124 BP897523 BG126295 AW039081 AI774744 BE462870 AI774160 BP901231 BP896978 BP899682 AW038691 AW037897 BP896972 DB702813 AI771990 AW041766 AI775031 AI772718 BP902687 BP899594 AW615866 AW443386 AW039579 BP901912 AI782262 BP898818 BG126211 DB708459 BG126221 BP896745 BG128191 BP902722 BP909285 BP896146 BG126624 BP897877 BI924046 BP899220 AW093955 DB689482 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |