| Detail of EST/Unigene TCSL78111 |
| Acc. | TCSL78111 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Actin-depolymerizing factor 1 OS=Petunia hybrida E-value=8e-58; Actin-depolymerizing factor 1 OS=Arabidopsis thaliana E-value=2e-55; Actin-depolymerizing factor 4 OS=Arabidopsis thaliana E-value=3e-54; Actin-depolymerizing factor 2 OS=Petunia hybrida E-value=7e-54; Actin-depolymerizing factor 7 OS=Oryza sativa subsp. japonica E-value=8e-53; |
| Length | 881 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (19 ESTs); LIBEST_024426 (9 ESTs); SRR015436 (7 ESTs); SL_Lyc_leaf (6 ESTs); SL_maturing_fruit (6 ESTs); SL_MicroLEAF3 (5 ESTs); SL_MicroFRUIT (5 ESTs); SL_MicroFRUIT2 (4 ESTs); SL_FLOWER_DEV (4 ESTs); SL_germ_seedlings_TAMU (3 ESTs); SL_breaker_fruit (3 ESTs); SL_CELL_BTI (3 ESTs); SL_CROWNGALL (2 ESTs); SL_ROOT (2 ESTs); SL_SHOOT_4WEEK (2 ESTs); SL_TAMU (2 ESTs); SL_flower_buds8 (1 ESTs); SL_flower_buds3 (1 ESTs); LIBEST_024456 (1 ESTs); SL_CDS (1 ESTs); SL_RES (1 ESTs); SL_cTOS (1 ESTs); SL_ROOT_DEF (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_FRUIT (1 ESTs); SL_GFRUIT (1 ESTs); |
| Sequence | GGCCATTACGCCGGGGAAGATTCACATAAAAACATCTCTTTCTTATTGAGCCTTGAAGCC |
| EST members of Unigene | AW931114 FS200099 BW687328 SRR015435.227625 BG630436 AW621283 DB699577 FS179488 DB720599 BP904190 SRR015435.211090 SRR015435.326457 DB682539 BP895158 BP892838 BP903846 DB691425 FS198892 BG133412 BG127644 AW037805 SRR015435.148676 FS193660 GO373503 FS199287 AI773414 DB711708 FS202796 FS202588 BW685491 FS197380 SRR015436.58027 DB719709 BP892378 SRR015436.169743 SRR015435.164235 BP886988 DB692745 SRR015435.114044 SRR015435.351512 BG630409 BP905143 DB720287 SRR015435.155894 BT013009 SRR015436.79176 SRR015436.192605 SRR015435.105604 SRR015436.24105 AI488908 DB690339 SRR015435.167608 AW650174 FS204821 SRR015436.257051 AW647828 BG631493 AW621965 BM535968 BE433861 BM413135 AW091871 BP904699 BW691998 AW651173 BW690797 BG126286 SRR015435.361336 AW622890 BP904665 SRR015436.197139 SRR015435.268865 BI924449 BF050741 DB709819 SRR015435.258998 SRR015435.201348 BP890728 AI486906 SRR015435.211070 BG629143 SRR015435.214358 BP893847 AW980004 BP902923 BI203384 SRR015435.220184 AW037657 BM409808 SRR015435.160064 BG134995 SRR015435.323500 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823744 |
| Trichome-related Gene from Literature | 823744 |