Detail of EST/Unigene TCHL54869 |
Acc. | TCHL54869 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=0; Glutathione reductase, chloroplastic OS=Glycine max E-value=0; Glutathione reductase, chloroplastic OS=Arabidopsis thaliana E-value=0; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=0; Glutathione reductase, chloroplastic (Fragment) OS=Spinacia oleracea E-value=6e-70; |
Length | 1428 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172 (16 ESTs); SRR546165 (12 ESTs); SRR546168 (12 ESTs); SRR546170 (4 ESTs); |
Sequence | GAGTACTTTTCCGTATATTCCATGCTACAATTTTTTGCTTTAGTTATTAACAAAATTGAT |
EST members of Unigene | SRR546170.101986 SRR546165.7098 SRR546165.225280 SRR546165.15789 SRR546170.151041 SRR546172.154013 SRR546172.129286 SRR546170.18484 SRR546172.37499 SRR546165.35534 SRR546168.82880 SRR546172.84875 SRR546165.228653 SRR546165.137438 SRR546168.40430 SRR546172.95368 SRR546172.72745 SRR546172.45685 SRR546172.70599 SRR546170.90417 SRR546172.137449 SRR546165.220236 SRR546168.13477 SRR546172.88268 SRR546165.222124 SRR546165.141920 SRR546165.14352 SRR546168.78708 SRR546172.98877 SRR546168.89911 SRR546165.97055 SRR546165.275615 SRR546172.11746 SRR546168.31406 SRR546168.16150 SRR546172.59139 SRR546168.121286 SRR546172.15454 SRR546172.128499 SRR546168.115669 SRR546168.113733 SRR546168.85908 SRR546168.99043 SRR546172.102978 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00383 glutathione reductase (NADPH) |
EC | 1.8.1.7 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824631 |
Trichome-related Gene from Literature | 824631 |