Detail of EST/Unigene TCMT40363 |
Acc. | TCMT40363 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=8e-88; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=1e-77; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Pyrus pyrifolia E-value=2e-76; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Malus sp. E-value=5e-76; Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=6e-75; |
Length | 762 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (12 ESTs); MT_DLEAF (8 ESTs); MT_DSIL (8 ESTs); MT_DSLC (6 ESTs); MT_UV-B (5 ESTs); MT_PhoLEAF (4 ESTs); MT_DSTEM2 (1 ESTs); MT_SIRRA (1 ESTs); MT_INSECT (1 ESTs); |
Sequence | CTGATTACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
EST members of Unigene | BQ136983 BF006747 BF006630 BF006020 BF005503 BF005196 BF005027 DY633293 DY633113 DY632598 DY632479 DY632467 BE317158 AW683171 BE249605 BE316568 BE317363 AW683502 AW683387 BE316585 BF521255 BF521161 BF521119 BF520529 BF519972 BF518559 BF518550 AW775645 BQ158660 BQ158636 BE323829 BF637469 BQ157366 CX523574 CX523029 CX521891 CX521710 CX520947 CX519933 CX519681 CX519236 CX519109 CX517487 CX517322 CX517124 BQ141580 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.19517.1.S1_at
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |