Detail of EST/Unigene TCMT41455 |
Acc. | TCMT41455 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase AtPK2/AtPK19 OS=Arabidopsis thaliana E-value=7e-74; Serine/threonine-protein kinase AtPK1/AtPK6 OS=Arabidopsis thaliana E-value=3e-73; Protein kinase 2 OS=Dictyostelium discoideum E-value=6e-57; RAC family serine/threonine-protein kinase homolog OS=Dictyostelium discoideum E-value=2e-50; Ribosomal protein S6 kinase alpha-6 OS=Homo sapiens E-value=1e-49; |
Length | 774 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (2 ESTs); MT_Shoots (1 ESTs); MT_Drought (1 ESTs); |
Sequence | TGATACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
EST members of Unigene | CX526214 BQ137101 AW693542 BF632689 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04688 p70 ribosomal S6 kinase |
EC | 2.7.11.1 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
Mtr.33355.1.S1_s_at, Mtr.41849.1.S1_at
|
Corresponding NCBI Gene | 820019 |
Trichome-related Gene from Literature | N/A |