Detail of EST/Unigene TCMT41463 |
Acc. | TCMT41463 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Translocon at the outer membrane of chloroplasts 64 OS=Pisum sativum E-value=0; Outer envelope protein 64, chloroplastic OS=Arabidopsis thaliana E-value=4e-90; Outer envelope protein 64, mitochondrial OS=Arabidopsis thaliana E-value=8e-64; Amidase 1 OS=Arabidopsis thaliana E-value=2e-55; Glutamyl-tRNA(Gln) amidotransferase subunit A OS=Legionella pneumophila (strain Corby) E-value=4e-17; |
Length | 1114 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (3 ESTs); MT_DSTEM2 (3 ESTs); MT_JAS_ROOR (2 ESTs); MtBA (2 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_PhoLEAF (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_Shoots (1 ESTs); MT_ECELL (1 ESTs); |
Sequence | TGATTCGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
EST members of Unigene | CX527531 BQ137114 AW689881 AW688585 BF648556 CB892039 BE324654 CX529168 CX528773 BF004539 AL373400 AL366811 BI267693 BF641713 BF641322 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00632 Benzoate degradation via CoA ligation > K01426 amidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K01426 amidase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01426 amidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K01426 amidase |
EC | 3.1.-.- 3.5.1.4 |
Transcription Factor Family | |
Transporter Classification Family | 3.A.9 Chloroplast protein translocating system (Tic-Toc) CEPT |
Probeset |
Mtr.37770.1.S1_s_at
|
Corresponding NCBI Gene | 819660 |
Trichome-related Gene from Literature | N/A |