| Detail of EST/Unigene TCMT42139 |
| Acc. | TCMT42139 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=0; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=0; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=0; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=0; Probable mannitol dehydrogenase 3 OS=Stylosanthes humilis E-value=0; |
| Length | 1322 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (2 ESTs); MT_VILEAF (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_DFLOWER (1 ESTs); MT_DLEAF (1 ESTs); MT_CDS (1 ESTs); MTUS_MIXTISSUE (1 ESTs); |
| Sequence | GGAATTATCATAACATAGTTTGAAATGGCAACAGAAGGTAAAGTAGTAGAGCATCCTAAG |
| EST members of Unigene | BT052068 CF067998 EV257932 EV256381 DW018280 BQ146448 BE249382 AW981393 AW776209 CX522803 CX522780 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
| EC | 1.1.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.38474.1.S1_at
|
| Corresponding NCBI Gene | 829954 |
| Trichome-related Gene from Literature | 829954 |