Detail of EST/Unigene TCMT42217 |
Acc. | TCMT42217 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glycosyltransferase At5g03795 OS=Arabidopsis thaliana E-value=0; Probable glycosyltransferase At5g25310 OS=Arabidopsis thaliana E-value=0; Probable glycosyltransferase At3g07620 OS=Arabidopsis thaliana E-value=0; Probable glycosyltransferase At3g42180 OS=Arabidopsis thaliana E-value=0; Probable glycosyltransferase At5g11130 OS=Arabidopsis thaliana E-value=0; |
Length | 1876 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (3 ESTs); MT_GPOD (2 ESTs); MT_DSTEM2 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_GESD (1 ESTs); MT_SROOT_KV2 (1 ESTs); GLSD (1 ESTs); MTUS_MIXTISSUE (1 ESTs); |
Sequence | TATAATAAAACTCTACTATATGTAACATTAATTAATAATAATATTACAATGGTTTTAGAA |
EST members of Unigene | CA923191 AL386362 AL386361 AL382271 AW694923 DW016885 CA991281 CA918241 CA917150 BM779417 BQ123366 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02366 glucuronyl/N-acetylglucosaminyl transferase EXT1; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02366 glucuronyl/N-acetylglucosaminyl transferase EXT1; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2 |
EC | 2.4.1.224 2.4.1.225 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12707.1.S1_at, Mtr.43588.1.S1_at
|
Corresponding NCBI Gene | 3770626 |
Trichome-related Gene from Literature | N/A |