| Detail of EST/Unigene TCMT42377 |
| Acc. | TCMT42377 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=0; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=3e-60; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=4e-59; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=5e-56; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-54; |
| Length | 951 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR (10 ESTs); MT_HOGA (5 ESTs); MT_JCVI-MT2 (4 ESTs); MT_DSIL (3 ESTs); MTUS_MIXTISSUE (1 ESTs); |
| Sequence | CAATTATCAAAGTCATAGAAAATTTAAGTGTTGCAATGGCTACAAATCAGGAACATGTGA |
| EST members of Unigene | CA920421 BF520163 BF519082 AW776999 CX534344 CX533708 CX533684 CX533251 CX532366 CX532090 CX530974 CX529765 CX529270 CX529150 CB894233 CB894063 BG648821 BG648745 BG646508 GE352177 GE347827 GE349489 GE344414 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
| EC | 2.5.1.18 5.2.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
Mtr.12316.1.S1_at
|
| Corresponding NCBI Gene | 817491 |
| Trichome-related Gene from Literature | N/A |