| Detail of EST/Unigene TCMT43890 |
| Acc. | TCMT43890 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP sulfurylase 2 OS=Arabidopsis thaliana E-value=0; ATP sulfurylase 1, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-sulfurylase 3, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP sulfurylase 4, chloroplastic OS=Arabidopsis thaliana E-value=0; Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 2 OS=Homo sapiens E-value=0; |
| Length | 1855 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF (3 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_Shoots (1 ESTs); MT_GESD (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_Drought (1 ESTs); |
| Sequence | ACATGATCATAGAAAACCACTTCTTGTGAATCCAATCCAACATGTTCGCCATAGTCATAG |
| EST members of Unigene | CF068680 CA919260 CX525254 EV259807 EV257385 BI312379 BQ138471 CX517720 CX516847 CX516731 BF632820 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00860 adenylylsulfate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00860 adenylylsulfate kinase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00860 adenylylsulfate kinase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00958 sulfate adenylyltransferase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00958 sulfate adenylyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00958 sulfate adenylyltransferase |
| EC | 2.7.1.25 2.7.7.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10952.1.S1_at, Mtr.20763.1.S1_s_at, Mtr.39425.1.S1_s_at, Mtr.45729.1.S1_s_at
|
| Corresponding NCBI Gene | 838580 |
| Trichome-related Gene from Literature | N/A |