| Detail of EST/Unigene TCMT43914 |
| Acc. | TCMT43914 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase 4 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase homolog MMK2 OS=Medicago sativa E-value=0; Mitogen-activated protein kinase 6 OS=Oryza sativa subsp. japonica E-value=0; Mitogen-activated protein kinase 2 OS=Oryza sativa subsp. japonica E-value=0; Mitogen-activated protein kinase 5 OS=Arabidopsis thaliana E-value=0; |
| Length | 1539 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_ECELL (1 ESTs); MT_DSIL (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_INSECT (1 ESTs); MT_CDS (1 ESTs); |
| Sequence | GGGTCTTACAAAATCCGTTGAAAATCACATTGAACAACTTGCTCAATAATATATTTTTTC |
| EST members of Unigene | BT052624 CF068024 CA918754 BF648002 EV262033 EV259850 AW776589 AW585332 CX532831 BE321510 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04464 mitogen-activated protein kinase 7; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04464 mitogen-activated protein kina |
| EC | 2.7.1.- 2.7.11.24 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
Mtr.11047.1.S1_at, Mtr.41091.1.S1_at
|
| Corresponding NCBI Gene | 828151 |
| Trichome-related Gene from Literature | N/A |