| Detail of EST/Unigene TCMT43947 |
| Acc. | TCMT43947 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase L3 OS=Arabidopsis thaliana E-value=8e-91; Protein IN2-1 homolog B OS=Oryza sativa subsp. japonica E-value=5e-83; Protein IN2-1 homolog B OS=Oryza sativa subsp. indica E-value=5e-83; Glutathione S-transferase L1 OS=Arabidopsis thaliana E-value=5e-82; Glutathione S-transferase L2, chloroplastic OS=Arabidopsis thaliana E-value=7e-81; |
| Length | 1095 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_CDS (2 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_JCVI-MT1 (1 ESTs); |
| Sequence | GAATGTAGTCGCAATTCTGTATAAGGTAAGAAATACTCATCACCCAAACCAAACCCCACA |
| EST members of Unigene | BT051862 BT050778 EV256610 DW019036 BM780107 CX531752 CX531341 BE203198 GE352238 GE347898 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
| Probeset |
Mtr.13201.1.S1_at
|
| Corresponding NCBI Gene | 831798 |
| Trichome-related Gene from Literature | N/A |