Detail of EST/Unigene TCMT44434 |
Acc. | TCMT44434 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Peroxisomal acyl-coenzyme A oxidase 1 OS=Arabidopsis thaliana E-value=1e-59; Putative peroxisomal acyl-coenzyme A oxidase 1.2 OS=Arabidopsis thaliana E-value=9e-55; Peroxisomal acyl-coenzyme A oxidase 1 OS=Rattus norvegicus E-value=3e-21; Peroxisomal acyl-coenzyme A oxidase 1 OS=Cavia porcellus E-value=2e-20; Peroxisomal acyl-coenzyme A oxidase 1 OS=Mus musculus E-value=3e-20; |
Length | 926 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (2 ESTs); MT_DROOT (1 ESTs); MTPOSE (1 ESTs); MT_SROOT_KV1 (1 ESTs); MTFLOW (1 ESTs); |
Sequence | CAGTTGATCGTTGTTTCCAAATTTATAGAGAAGTTGCAGCAAGATATACCTGGAAAGGGA |
EST members of Unigene | BE320639 AJ498488 BE202528 AJ497011 GE350300 GE345332 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
EC | 1.3.3.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.38936.1.S1_at
|
Corresponding NCBI Gene | 827381 |
Trichome-related Gene from Literature | N/A |