Detail of EST/Unigene TCMT44621 |
Acc. | TCMT44621 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase-like 9 OS=Arabidopsis thaliana E-value=0; 4-coumarate--CoA ligase-like 5 OS=Oryza sativa subsp. japonica E-value=0; 4-coumarate--CoA ligase-like 6 OS=Oryza sativa subsp. japonica E-value=0; 4-coumarate--CoA ligase-like 7 OS=Oryza sativa subsp. japonica E-value=0; 4-coumarate--CoA ligase-like 5 OS=Arabidopsis thaliana E-value=0; |
Length | 1532 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_DLEAF (1 ESTs); MT_DSIL (1 ESTs); MT_VILEAF (1 ESTs); |
Sequence | CTCATCCCTTCTTCCATACATGTCCCCGTACTCTATTTCTCCCTCCTCTCCCTCGGCGTC |
EST members of Unigene | AW693894 EV261904 BG454544 AW776080 CX523046 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
EC | 6.2.1.12 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
Mtr.44778.1.S1_at, Mtr.45561.1.S1_at
|
Corresponding NCBI Gene | 836457 |
Trichome-related Gene from Literature | N/A |