| Detail of EST/Unigene TCMT44717 |
| Acc. | TCMT44717 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative lipid phosphate phosphatase 3, chloroplastic OS=Arabidopsis thaliana E-value=0; Lipid phosphate phosphatase 2 OS=Arabidopsis thaliana E-value=0; Lipid phosphate phosphatase 1 OS=Arabidopsis thaliana E-value=0; Phosphatidate phosphatase PPAPDC1B OS=Mus musculus E-value=3e-41; Phosphatidate phosphatase PPAPDC1B OS=Homo sapiens E-value=2e-40; |
| Length | 1372 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_GPOD (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
| Sequence | CCTCTTTCCATTTTCAGGTCTCATTTTCAATCTCTTTGAATGGTTTTCTTTGCTGCTTCA |
| EST members of Unigene | EV261061 CA917993 EY474928 GE352178 GE347828 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K01080 phosphatidate phosphatase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K01080 phosphatidate phosphatase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K01080 phosphatidate phosphatase; Metabolism > Lipid Metabolism > ko00600 Sphingolipid metabolism > K01080 phosphatidate phosphatase |
| EC | 3.1.3.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.30681.1.S1_at
|
| Corresponding NCBI Gene | 821299 |
| Trichome-related Gene from Literature | N/A |