Detail of EST/Unigene TCMT47143 |
Acc. | TCMT47143 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Microsomal glutathione S-transferase 3 OS=Bos taurus E-value=3e-23; Microsomal glutathione S-transferase 3 OS=Mus musculus E-value=4e-22; Microsomal glutathione S-transferase 3 OS=Homo sapiens E-value=5e-22; Microsomal glutathione S-transferase 2 OS=Homo sapiens E-value=4e-08; Microsomal glutathione S-transferase 2 OS=Bos taurus E-value=9e-08; |
Length | 833 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTFLOW (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_CDS (1 ESTs); MT_JCVI-MT1 (1 ESTs); MTPOSE (1 ESTs); MT_PhoLEAF (1 ESTs); MT_VILEAF (1 ESTs); |
Sequence | CTTCAGAAAAAAACTAACAAGAAACAAACCATCATCCAAAAATGGCGACACTGATAGAAT |
EST members of Unigene | BT051308 EV256409 AJ498824 BG458011 CX518337 AJ497200 GE345068 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.38408.1.S1_at, Mtr.38408.1.S1_s_at
|
Corresponding NCBI Gene | 842893 |
Trichome-related Gene from Literature | N/A |