Detail of EST/Unigene TCMT47982 |
Acc. | TCMT47982 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor A protein 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=8e-24; Replication protein A 32 kDa subunit OS=Rattus norvegicus E-value=1e-20; Replication protein A 32 kDa subunit OS=Homo sapiens E-value=2e-19; Replication protein A 32 kDa subunit OS=Pongo abelii E-value=2e-19; Replication protein A 32 kDa subunit OS=Mus musculus E-value=2e-18; |
Length | 1065 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE (2 ESTs); MT_NOD_GVN (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); |
Sequence | TGTTAAATTCAGACGTGAGATCATTTAAAGTGTTCGGTAATTTAGTCAAAAAACATAATA |
EST members of Unigene | CF069643 CA920053 BG582275 AI737490 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10739 replication factor A2 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41923.1.S1_at
|
Corresponding NCBI Gene | 816985 |
Trichome-related Gene from Literature | N/A |