| Detail of EST/Unigene TCMT48523 |
| Acc. | TCMT48523 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Presenilin-like protein At1g08700 OS=Arabidopsis thaliana E-value=3e-67; Presenilin-like protein At2g29900 OS=Arabidopsis thaliana E-value=6e-42; Presenilin-B OS=Dictyostelium discoideum E-value=4e-14; Presenilin-A OS=Dictyostelium discoideum E-value=4e-14; Presenilin-2 OS=Xenopus laevis E-value=5e-13; |
| Length | 887 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1 (1 ESTs); MT_HOGA (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
| Sequence | GAAAAAAGTAAACAAAAACTCAAGCTTAGTACCCCCTCATAGAAGAATTAAACTCATCTC |
| EST members of Unigene | EV259306 BG646467 EY476248 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04505 presenilin 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04505 presenilin 1; Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04522 presenilin 2 |
| EC | 3.4.23.- |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.5 Polycystin cation channel PCC |
| Probeset |
Mtr.2485.1.S1_at
|
| Corresponding NCBI Gene | 837391 |
| Trichome-related Gene from Literature | N/A |