| Detail of EST/Unigene TCMT49858 |
| Acc. | TCMT49858 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, cytosolic OS=Oryctolagus cuniculus E-value=1e-53; Serine hydroxymethyltransferase, mitochondrial OS=Homo sapiens E-value=3e-53; Serine hydroxymethyltransferase, cytosolic OS=Bos taurus E-value=5e-53; Serine hydroxymethyltransferase, mitochondrial OS=Bos taurus E-value=7e-53; Serine hydroxymethyltransferase, cytosolic OS=Pongo abelii E-value=7e-53; |
| Length | 952 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
| Sequence | GAAGAACAATTAAGGGTTTACTAAATCTTTAGTACAACTAAAATAATAGCTTAACTGTAA |
| EST members of Unigene | CA922500 AL384284 BE205030 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10856.1.S1_at
|
| Corresponding NCBI Gene | 829387 |
| Trichome-related Gene from Literature | N/A |