Detail of EST/Unigene TCMT50311 |
Acc. | TCMT50311 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase kinase kinase A OS=Dictyostelium discoideum E-value=2e-17; Serine/threonine-protein kinase CLA4 OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) E-value=7e-16; Mitogen-activated protein kinase kinase kinase 1 OS=Arabidopsis thaliana E-value=1e-15; Kinase and exchange factor for Rac B OS=Dictyostelium discoideum E-value=1e-15; Probable serine/threonine-protein kinase DDB_G0272254 OS=Dictyostelium discoideum E-value=2e-15; |
Length | 1501 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD (3 ESTs); MT_JCVI-MT2 (2 ESTs); MT_GSEED (1 ESTs); MT_NOD_GVN (1 ESTs); MT_DLEAF (1 ESTs); MT_DSIL (1 ESTs); |
Sequence | ACCTTATGATATTAGAGAAGAGAAATACACCGAATATTTCTGCAGGTACATTCCTCTTCG |
EST members of Unigene | CX540280 AW574056 BG452214 BF520887 BQ124183 BQ124138 BQ124051 GE351672 GE347250 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04420 mitogen-activated protein kinase kinase kinase 2; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K05734 p21-activated kinase 4; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K05735 p21-activated kinase 6 |
EC | 2.7.11.1 |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
Mtr.38465.1.S1_at
|
Corresponding NCBI Gene | 839441 |
Trichome-related Gene from Literature | N/A |