Detail of EST/Unigene TCMT50671 |
Acc. | TCMT50671 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase L1 OS=Arabidopsis thaliana E-value=4e-67; Glutathione S-transferase L2, chloroplastic OS=Arabidopsis thaliana E-value=1e-66; Protein IN2-1 homolog B OS=Oryza sativa subsp. japonica E-value=2e-66; Protein IN2-1 homolog B OS=Oryza sativa subsp. indica E-value=2e-66; Glutathione S-transferase L3 OS=Arabidopsis thaliana E-value=3e-65; |
Length | 885 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (2 ESTs); MT_Shoots (1 ESTs); MT_DSLC (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT2 (1 ESTs); |
Sequence | AAGAGTTAAGCTGCATCAACATAGAGTGATGAATATTCATTGTCATCATTTTGGAATTAT |
EST members of Unigene | CX528456 BF005262 CX523547 CX519594 BG449258 GE343728 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00310 pyrimidodiazepine synthase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 1.5.4.1 1.8.5.1 2.5.1.18 2.8.-.- |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
Mtr.38772.1.S1_at
|
Corresponding NCBI Gene | 831800 |
Trichome-related Gene from Literature | N/A |