Detail of EST/Unigene TCMT52601 |
Acc. | TCMT52601 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=0; Cytochrome P450 71B34 OS=Arabidopsis thaliana E-value=0; Cytochrome P450 71B35 OS=Arabidopsis thaliana E-value=0; Cytochrome P450 71B26 OS=Arabidopsis thaliana E-value=0; Cytochrome P450 71B37 OS=Arabidopsis thaliana E-value=0; |
Length | 1578 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN (4 ESTs); MT_NOD_ROOT (2 ESTs); MT_IROOT_DSIR (2 ESTs); MT_CDS (1 ESTs); |
Sequence | CAAAAACATGTCACCCCTTATTCTTTTACCCTTTGCTCTCTTGCTATTCTTCTTGTTCAA |
EST members of Unigene | DQ394575 AW559818 AW559816 BG583746 BG581908 BG581185 AW980423 AW686218 AW686548 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37357.1.S1_at
|
Corresponding NCBI Gene | 829277 |
Trichome-related Gene from Literature | N/A |