Detail of EST/Unigene TCMT52644 |
Acc. | TCMT52644 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase parA OS=Nicotiana tabacum E-value=2e-83; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=8e-78; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-77; Probable glutathione S-transferase MSR-1 OS=Nicotiana plumbaginifolia E-value=3e-76; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=1e-73; |
Length | 1175 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_UV-B (5 ESTs); MT_JCVI-MT2 (4 ESTs); MT_JAS_ROOR (4 ESTs); MT_DLEAF (2 ESTs); MT_HOGA (2 ESTs); MT_DFLOWER (1 ESTs); MT_SIRRA (1 ESTs); MT_MGHG (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | AAATAACTCAAACACCCACAAAGATTTAAATCATCTAACAACATCTTAGTTTCAACATAC |
EST members of Unigene | DY632990 DY632912 DY632809 DY632626 DY632625 BI270029 BG454634 BG452453 BQ152831 CX534694 CX534106 CX531216 CX528650 CB895208 BG648944 BE942506 BI267659 EY477632 GE348678 GE348594 GE343462 GE343348 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
Mtr.10502.1.S1_s_at, Mtr.40293.1.S1_at
|
Corresponding NCBI Gene | 838289 |
Trichome-related Gene from Literature | N/A |