Detail of EST/Unigene TCMT53436 |
Acc. | TCMT53436 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase 3 OS=Glycine max E-value=1e-96; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=3e-84; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=8e-84; Probable glutathione S-transferase parA OS=Nicotiana tabacum E-value=3e-78; Glutathione S-transferase U19 OS=Arabidopsis thaliana E-value=4e-78; |
Length | 953 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (2 ESTs); MT_ROOTPHOS (2 ESTs); MTAMP (2 ESTs); MT_CDS (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_HOGA (1 ESTs); |
Sequence | GGGTAACAACCTATAATTCACTTTCACTTGGGATTTAGTGATTCTCTACAATCATGGCAA |
EST members of Unigene | BT051340 EV256830 EV255327 AW329262 AW329038 AJ502883 AJ502767 CX530212 BG646784 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
Mtr.37761.1.S1_s_at, Mtr.6919.1.S1_s_at
|
Corresponding NCBI Gene | 844174 |
Trichome-related Gene from Literature | N/A |