| Detail of EST/Unigene TCMT55872 |
| Acc. | TCMT55872 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A oxidase 2, peroxisomal OS=Arabidopsis thaliana E-value=5e-87; Acyl-coenzyme A oxidase, peroxisomal OS=Cucurbita maxima E-value=4e-86; Putative acyl-coenzyme A oxidase 3.2, peroxisomal OS=Arabidopsis thaliana E-value=7e-20; Acyl-coenzyme A oxidase 3, peroxisomal OS=Arabidopsis thaliana E-value=1e-19; Acyl-coenzyme A oxidase-like protein OS=Homo sapiens E-value=9e-18; |
| Length | 904 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3 (5 ESTs); MT_JAS_ROOR (3 ESTs); MT_Drought (2 ESTs); MT_DSTEM2 (2 ESTs); MT_JCVI-MT3 (1 ESTs); MT_Shoots (1 ESTs); |
| Sequence | CAAATATTCAATGCCGTATCATCACAACCAAAACTTAATCCATAATTCCAAATAACTGCC |
| EST members of Unigene | CX524195 AW694028 AW688970 CB892031 BG645332 BG645076 AW736113 AW736027 CX534349 CX533688 CX529963 BF636323 BF635291 EY475134 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
| EC | 1.3.3.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.12609.1.S1_at
|
| Corresponding NCBI Gene | 836635 |
| Trichome-related Gene from Literature | N/A |