Detail of EST/Unigene TCMT56878 |
Acc. | TCMT56878 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Carboxymethylenebutenolidase homolog OS=Rattus norvegicus E-value=3e-17; Carboxymethylenebutenolidase homolog OS=Homo sapiens E-value=7e-17; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=7e-17; Carboxymethylenebutenolidase homolog OS=Pongo abelii E-value=1e-16; Carboxymethylenebutenolidase homolog OS=Xenopus tropicalis E-value=1e-14; |
Length | 1106 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL (3 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_DLEAF (1 ESTs); MT_PhoLEAF (1 ESTs); |
Sequence | CACCAGGGTAAAGTGAAGATGGGGCTAGCAACAGCAAGAGCAACTGTAAGCATTTGTGGT |
EST members of Unigene | CF068322 CA919013 BE318216 BF521063 BF518666 AW776989 BE324903 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.49177.1.S1_at
|
Corresponding NCBI Gene | 840434 |
Trichome-related Gene from Literature | N/A |