Detail of EST/Unigene TCMT57396 |
Acc. | TCMT57396 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP] OS=Glycine max E-value=6e-47; Isocitrate dehydrogenase [NADP], chloroplastic (Fragment) OS=Medicago sativa E-value=8e-47; Isocitrate dehydrogenase [NADP] OS=Nicotiana tabacum E-value=2e-46; Isocitrate dehydrogenase [NADP] OS=Solanum tuberosum E-value=4e-45; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Microtus ochrogaster E-value=8e-33; |
Length | 817 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MT_VILEAF (1 ESTs); MT_HOGA (1 ESTs); MT_JCVI-MT2 (1 ESTs); |
Sequence | AAACAAACTTCCATATCTATAGAAAATGACAGAAATTTTTATAATGCATGTAATCATTTT |
EST members of Unigene | CA921813 CX517580 BG648891 GE351808 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
EC | 1.1.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12789.1.S1_at
|
Corresponding NCBI Gene | 842905 |
Trichome-related Gene from Literature | N/A |