Detail of EST/Unigene TCMT59532 |
Acc. | TCMT59532 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 5 OS=Homo sapiens E-value=2e-96; Replication factor C subunit 5 OS=Mus musculus E-value=3e-96; Probable replication factor C subunit 5 OS=Dictyostelium discoideum E-value=4e-90; Replication factor C subunit 3 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-82; Probable replication factor C subunit 5 OS=Caenorhabditis elegans E-value=8e-73; |
Length | 1157 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (2 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_DFLOWER (1 ESTs); MT_DROOT (1 ESTs); MT_NOD_GVSN (1 ESTs); |
Sequence | CAGCTCACCGCGACATCGTTGACACAATTGATAGGTTGACTACTGAGAATAGATTACCCC |
EST members of Unigene | BG448514 BE997402 AW775101 BQ147848 GE349443 GE344357 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10756 replication factor C subunit 3/5 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.9170.1.S1_at
|
Corresponding NCBI Gene | 844083 |
Trichome-related Gene from Literature | N/A |