Detail of EST/Unigene TCMT59550 |
Acc. | TCMT59550 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 21 OS=Arabidopsis thaliana E-value=2e-71; SKP1-like protein 20 OS=Arabidopsis thaliana E-value=4e-70; SCF ubiquitin ligase complex protein SKP1b OS=Dictyostelium discoideum E-value=3e-13; SCF ubiquitin ligase complex protein SKP1a OS=Dictyostelium discoideum E-value=5e-13; SKP1-like protein 1A OS=Arabidopsis thaliana E-value=9e-12; |
Length | 1519 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3 (2 ESTs); GLSD (2 ESTs); MtBA (2 ESTs); MHRP-root (1 ESTs); MT_GPOD (1 ESTs); MT_MGHG (1 ESTs); |
Sequence | TTCTTCACGAACGAATCACATCTTCTCTGCCTCACCGCCGCTCAATTACCGGCGGCAGCT |
EST members of Unigene | BG588269 AW775058 AW773863 BI307842 CA858746 CA858632 AL365921 AL365920 BE942004 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40888.1.S1_at, Mtr.4546.1.S1_s_at
|
Corresponding NCBI Gene | 825314 |
Trichome-related Gene from Literature | N/A |