Detail of EST/Unigene TCMT60245 |
Acc. | TCMT60245 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | RING-box protein 1a OS=Arabidopsis thaliana E-value=5e-53; RING-box protein 1 OS=Salmo salar E-value=7e-51; E3 ubiquitin-protein ligase RBX1 OS=Mus musculus E-value=7e-51; E3 ubiquitin-protein ligase RBX1 OS=Homo sapiens E-value=7e-51; RING-box protein 1A OS=Drosophila melanogaster E-value=2e-50; |
Length | 630 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MTAMP (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_TRI (1 ESTs); |
Sequence | CATTCGAAAATCGAAATAAACGAAACAGTACACACAAAGAATCACATCACAGTTGTTGCG |
EST members of Unigene | EV259676 DW016224 AJ501232 EY477828 ES613355 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03868 RING-box protein 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K03868 RING-box protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03868 RING-box protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03868 RING-box protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.31250.1.S1_at
|
Corresponding NCBI Gene | 832179 |
Trichome-related Gene from Literature | N/A |