Detail of EST/Unigene TCSL71655 |
Acc. | TCSL71655 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Late embryogenesis abundant protein Lea5 OS=Citrus sinensis E-value=3e-07; Late embryogenesis abundant protein Lea5-D OS=Gossypium hirsutum E-value=7e-07; Late embryogenesis abundant protein Lea5-A OS=Gossypium hirsutum E-value=3e-06; |
Length | 1074 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (26 ESTs); SL_TAMU (12 ESTs); SL_SUS_LEAF (7 ESTs); LIBEST_024426 (6 ESTs); SL_MicroLEAF3 (6 ESTs); SL_MicroFRUIT2 (4 ESTs); SL_MicroFRUIT (4 ESTs); SL_maturing_fruit (3 ESTs); LIBEST_025267 (2 ESTs); SL_ROOT_pre-anthesis (2 ESTs); SL_RES (1 ESTs); SL_FRUIT (1 ESTs); SL_breaker_fruit (1 ESTs); SL_cTOS (1 ESTs); SL_TRI (1 ESTs); SRR015436 (1 ESTs); SL_pericarp (1 ESTs); |
Sequence | GGCCATTACGGCCGGGGACATATCTAACATTTTCCTTCAGATTTTAAAAAAAATTTCAAA |
EST members of Unigene | AI772069 AI782790 CD002941 SRR015435.293752 BM412214 SRR015435.197936 AI782784 DB719374 AI488397 SRR015435.86159 AI777949 GT167414 BW691686 SRR015435.286174 BW691072 AI487817 DB689423 SRR015435.31641 AI782428 SRR015435.269160 SRR015435.282539 SRR015436.159529 BW691835 BP895066 AI897429 AI779261 DB706059 SRR015435.339139 DB724689 AI898990 BP890643 BE436690 FS193413 DB717249 BI206547 SRR015435.27779 SRR015435.191332 ES896687 FS197467 DB682416 SRR015435.313209 AI899323 SRR015435.201695 FS179662 SRR015435.25121 SRR015435.259937 AI771261 AI779185 FS200168 SRR015435.559 SRR015435.57135 AI486006 AI489119 SRR015435.272505 AI771285 DB693099 AI777468 AI487707 SRR015435.180506 DB685017 SRR015435.210496 AI487081 SRR015435.336158 SRR015435.346233 BP894944 FS186524 BF114354 BW687152 SRR015435.95954 SRR015435.158521 AI490040 BF113767 FS206361 DB725446 GT166821 DB704863 SRR015435.339040 SRR015435.147505 SRR015435.348160 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828053 |
Trichome-related Gene from Literature | 828053 |